Determine the necessary mass, volume, or concentration for preparing a solution.
This is a demo store. No orders will be fulfilled.
| SKU | Size | Availability |
Price | Qty |
|---|---|---|---|---|
|
S659212-1mg
|
1mg |
Available within 8-12 weeks(?)
Production requires sourcing of materials. We appreciate your patience and understanding.
|
$200.90
|
|
|
S659212-5mg
|
5mg |
Available within 8-12 weeks(?)
Production requires sourcing of materials. We appreciate your patience and understanding.
|
$530.90
|
|
|
S659212-10mg
|
10mg |
Available within 8-12 weeks(?)
Production requires sourcing of materials. We appreciate your patience and understanding.
|
$840.90
|
|
| Specifications & Purity | ≥96% |
|---|---|
| Storage Temp | Store at -20°C,Desiccated |
| Shipped In |
Ice chest + Ice pads This product requires cold chain shipping. Ground and other economy services are not available. |
| Product Description |
SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. Appearance:Solid Biological Activity:SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. |
| Smiles | [RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA (UUAAGAGGCUUGCACAGUGCA) (1:1)] |
|---|
| Solubility | H2O : ≥ 100 mg/mL |
|---|